EST details — SGN-E526918

Search information 
Request: 526918Match: SGN-E526918
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326663Clone name: PetuniaLF-1-F06
nocartOrdering Not Available
Library Name: Petunia-LFOrganism: Petunia hybrida

Tissue: leaves
Development Stage: various

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526918Length: 261 bp (1192 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526918 [] (trimmed) AACAGGACCAATTGACAACCTTTTCGCTCACCTTGCTGATCCCGGTCACGCCACTATTTTTTGCTGCTTTCAGTCCAAAGTGAGAAGCAGGAGGC
ACCATTTGTTGGCATTAGTGTGTTGGGGTGACACTCAGAAGAACTGAAGAAAGATTTGTAGAAATTGTTTTCCCACTTAATGTATCGGTATACTT
GAGTTTCCACTGTGTCTATCTTCAGTGTACAAAATATAATATCAGGACCTCATTAGGCTGCAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526918] SGN-U208524 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336417 [Download] [View] Facility Assigned ID: PetuniaLF-1-F06.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0058 Quality Trim Threshold: 12.5