Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E527044

Search information 
Request: 527044Match: SGN-E527044
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327736Clone name: PetuniaRF-1-H12
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527044Length: 411 bp (931 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527044 [] (trimmed) CTTATCTGCAAAATTGAGTGGTAGTTGATATAACCAGACATGTTTCTAGTTGATTGGTTTTATGGAGTGTTAGCATCATTAGGGCTGTGGAATAA
GGAAGCTAAGATCTTGTTCTTAGGGCTTGATAATGCTGGCAAAACTACTTTGCTTCATATGTTGAAAGATGAGAGACTGGTGCAGCATCAACCTA
CACAATACCCGACATCAGAGGAGTTGAGTATAGGAAGAATTAAGTTCAAGGCTTTTGATTTAGGAGGACACCAAATTGCTAGAAGAGTCTGGAGA
GACTACTATGCCAAGGTGGACGCTGTTGTTTATCTTGTAGATGCTTATGACCGAGAGAGGTTTCCAGAGTCTAAGAGGGAACTAGATGGCCTTCT
CTCAGATGAGTCGTTGGCAAATGTCCCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527044] SGN-U209064 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337490 [Download] [View] Facility Assigned ID: PetuniaRF-1-H12.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0167 Quality Trim Threshold: 14.5