EST details — SGN-E527094

Search information 
Request: 527094Match: SGN-E527094
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327786Clone name: PetuniaRF-2-E03
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527094Length: 666 bp (723 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527094 [] (trimmed) CTTGGTAATCACATATACTATAAGCTCAAAAACACATCTAAACACTCAGAAACACTTACTTTTGCAAAAAATATGGAGAACTTCCCAATTATCAA
CTTGGAAAAGCTCAATAGTGCTGAGAGAGATGCCACCATGGAAATGATTAAAGATGCCTGCGAAAACTGGGGCTTCTTTGAGTTGGTGAACCATG
GGATTCCACATGAAGTAATGGACACAGTGGAAAAATTGACAAAGGGACATTACAAGAAGTGCATGGAGCAGAGGTTTAAGGAATTGGTGGCCAGC
AAGGGTCTTGAAGCTGTGCAAGCTGAGGTTACTGATTTGGATTGGGAAAGCACTTTCTTCTTGCGCCATCTTCCTGTTTCTAACATCTCTGAAGT
ACCCGATCTTGATGATGAATACAGAGAGGTCATGAGAGATTTTGCTAAAAGATTGGAGAAGTTAGCTGAGGAGCTACTAGACTTGCTCTGTGAAA
ATCTTGGTCTTGAAAAGGGTTACTTGAAGAAGGCCTTTTATGGATCAAAAGGTCCTAACTTTGGAACTAAGGTGAGCAATTATCCCCCATGCCCC
AAGCCAGATTTGATAAAGGGACTGCGCGCCCACACAGATGCTGGGGGCATTATACTTCTCTTCCAAGACGACAAAGTGAGCGGGTTGCAACTCCT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527094] SGN-U207981 Petunia hybrida Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337540 [Download][View] Facility Assigned ID: PetuniaRF-2-E03.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5