Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E527390

Search information 
Request: 527390Match: SGN-E527390
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328082Clone name: PetuniaRF-5-F03
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527390Length: 614 bp (683 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527390 [] (trimmed) GGAAACACAAAAATATAAGCTAACGATTCTTTANCAATGGCTTCCTCAGTGATGTCCTCAGCTGCAGTTGCCACAAGCACCAATGCTGCTCAAGC
CAGCATGGTTGCACCCTTCACTGGCCTCAAGTCTGCAGCCTCCTTCCCTGTTTCCAGGAAACAGAACCTTGACATTACTTCCATTGCTAGCAATG
GTGGAAGAGTTCAATGCATGCAGGTGTGGCCACCATACGGCAAGAAGAAGTACGAAACTCTCTCATACCTTCCTGATTTGACTGACGAGCAGCTC
CTCAAGGAAATTGAGTACCTTTTGAACAAGGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTCGTCTACCGTGAGTACCATGCATC
TCCAGGGTACTATGATGGCAGGTACTGGACCATGTGGAAGCTGCCCATGTTCGGGTGCACTGATGCCACCCAGGTCTTGGGTGAGCTCCAGGAGG
CCAAGAAGGCTTACCCCAATGCCTGGATCAGAATCATTGGATTCGACAACGTGCGTCAAGTGCAATGCATCAGTTTCATTGCCTACAAGCCCCCA
GGCTACTAGATTTCATTTTAAAACAACCTATCCTCTGTTTTTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527390] SGN-U207453 Petunia hybrida Build 1 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337836 [Download][View] Facility Assigned ID: PetuniaRF-5-F03.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5