Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E527463

Search information 
Request: 527463Match: SGN-E527463
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328155Clone name: PetuniaRF-6-D05
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527463Length: 610 bp (719 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527463 [] (trimmed) AACTTAACTGCAAAATTGAGTGGTAGTTGATATAATAGCCATGTTTCTAGTTGATTGGTTTTATGGAGTGTTAGCATCATTAGGGCTGTGGAATA
AGGAAGCTAAGATCTTGTTCTTAGGGCTTGATAATGCTGGCAAAACTACTTTGCTTCATATGTTGAAAGATGAGAGACTGGTGCAGCATCAACCT
ACACAATACCCGACATCAGAGGAGTTGAGTATAGGAAGAATTAAGTTCAAGGCTTTTGATTTAGGAGGACACCAAATTGCTAGAAGAGTCTGGAG
AGACTACTATGCCAAGGTGGACGCTGTTGTTTATCTTGTAGATGCTTATGACCGAGAGAGGTTTCCAGAGTCTAAGAGGGAACTAGATGGCCTTC
TCTCAGATGAGTCGTTGGCAAATGTCCCATTTCTTATTCTGGGAAACAAGATTGATATCCCATATGCTGTTTCAGAAGACGAGCTGCGCTATCAC
TTGGGCCTTACTGGTGTGACCACTGGGAAAGGTAGCGTCAACCTCGCTGATTCCAATGTCCGTCCAATTGAGGTGTTTATGTGCAGCATAGTGAA
AAAGATGGGATATGGTGATGGCTTCAAGTGGATGTCTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527463] SGN-U209064 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337909 [Download][View] Facility Assigned ID: PetuniaRF-6-D05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5