Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E527739

Search information 
Request: 527739Match: SGN-E527739
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328431Clone name: PetuniaRF-9-C09
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527739Length: 627 bp (685 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E527739 [] (trimmed) AAAAAAATGGTGGATGAGTTTATGGTATGTGTAGATAGGATGATAATAGCAACAACATGTTATGGTGAAGACTCATCACTTAATAATAATAATAC
TCTATTGACTACTAGTTCTACTACTCATAATGATGAAAAAAACAATTCAAATGAAGAAATGGTTAGTAGTAATGGAGAAGGTAGTTCAAAGGGTG
GTGTTATTAGAGAGTGTAGGATTTGTCAAGAAGAAGATGATGAAAATGACATGGAATCTCCTTGTGCTTGCAATGGCACTCTCAAGTTTGCTCAT
AGGAAATGTATTCAGAGATGGTGCAATAAAAAAGGTGACATCACCTGTGAAATCTGTAATAAGGTCTTTTCACCAAACTATACCCTTCCACCTGC
AAGGAGCAACCCTGATGTAATGGCAATTGATATCAGGCAAGCATGGGGACCAGGCATGGATATTAGGAATCCTCATTTTCTGGCTTTTGCTGCTG
CTGAGCGTCAATTCCTGCAGTCAGAGTATGATGACTATGCCATTGCTAGCAGTGGGAGTCTAGCATGTTTCCGCTATGTTGCAATTATTTTGATG
CTACTCTTGCTGATACGCCAAACCTTGATGGTCATAAGGGACTTCGCGAAGGTGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527739] SGN-U208776 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338185 [Download][View] Facility Assigned ID: PetuniaRF-9-C09.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5