Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E527960

Search information 
Request: 527960Match: SGN-E527960
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C321860Clone name: Petunia-PP-11-F03
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527960Length: 389 bp (861 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527960 [] (trimmed) AGGGAAAAAGGCAGCTGAGATCTACTCATTTTATCCAGCGTGTATTTGATTCACAAAGAGGGGGCTGTCTTTCACTAAACTCTTCAGCCGCCTCT
TTGCGAAGAAGGAAATAGCGTATTCTTATGGTTGGTCTCGATGCTGCTGGTAAAACCACAATTCTCTACAAGCTCAAGTTGGGAGAAATTGTCAC
AACCATCCCAGGCATGGGCTTCAATGTGGAGACTGTTGAATACAAGAACATCAGCTTTACTGTGTGGGATGTCGGGGGTCAGGACAAGATTAGAC
CTCTATGGAGGCATTATTTCCAGAACACACAAGGTCTTATCTTTGTGGTTGACAGCAATGACCGAGACCGTGTGGTTGAGGCAAGGGATGAGCTT
CACAGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527960] SGN-U207620 Petunia hybrida Build 1 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T332286 [Download] [View] Facility Assigned ID: Petunia-PP-11-F03.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0099 Quality Trim Threshold: 20.5