EST details — SGN-E528282

Search information 
Request: 528282Match: SGN-E528282
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C322183Clone name: Petunia-PP-15-A02
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E528282Length: 334 bp (708 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E528282 [] (trimmed) GCTAACAGAGTGGATGAGGCCCTTGGGTTCATGAATGCTGCTGGACTTACAACGGACCATCCTATCATGACAACCACCGAGTTCTGGACATCTCA
TGAGTGCTTACCTTTGCCCTATGAGCAGTCACTAACTCGATTGGATTCGACTTCTGGCCTTTACTATGATTGCTCTGCCCATTTTCTTTGGGTTG
GAGAGAGAACTAGGCAGTTGGATGGTGCCCATGTCGAGTTCTTGAGAGGAATCGCCAACCCCCTTGGTATTAAGGTGAGTGACAAGATGGACCCA
AGTGCATTGGTCAAGCTCATTGAGATTTTGAACCCTCAAAACAAGGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E528282] SGN-U207562 Petunia hybrida Build 1 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T332609 [Download] [View] Facility Assigned ID: Petunia-PP-15-A02.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0086 Quality Trim Threshold: 20.5