EST details — SGN-E529263

Search information 
Request: 529263Match: SGN-E529263
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C323164Clone name: Petunia-PP-9-B11
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E529263Length: 304 bp (1338 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E529263 [] (trimmed) GAAGAAGAGAGAATAAGGTAGCCATGTCTGACGAAGAATACCATTTCTGAATCAAAAGCAGATGCTGGTGCATCCAAAACTTACCCTCAACAAGC
TGGTACCATTCGCAAGAATGGTTATATAGTTATTAAATGGCAGACCCTGCAATGGTTGTTGAGGTTTCCACTTCCAAAACTGGCAAGCATGGACA
TGCAAAGTTGTCACTCTGTGGCACTTGACATTTTCAATGGAAAGAAGCTTGACGATATTTGTTCCTTCCTCCCACAACTGTGATGTGCCACATGT
TAATCGTACAGATTATCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E529263] SGN-U207658 Petunia hybrida Build 1 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T332054 [Download] [View] Facility Assigned ID: Petunia-PP-9-B11.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0334 Quality Trim Threshold: 14.5