Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E530382

Search information 
Request: 530382Match: SGN-E530382
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C316489Clone name: cPHA-3-N8
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E530382Length: 551 bp (694 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E530382 [] (trimmed) TTTCTCTCTATCTCTCTTCATTCATCACTGCATTGAAAAAAGATGGGGTTGTCATTCGGGAAGCTTTTCAGTCGGCTTTTTGCCAAGAAGGAGAT
GCGTATCCTCATGGTTGGTCTCGATGCAGCTGGTAAAACCACCATATTGTACAAGCTCAAGCTTGGAGAGATTGTTACCACCATTCCTACCATTG
GATTCAACGTGGAGACTGTTGAATACAAGAACATAAGCTTCACTGTCTGGGATGTTGGAGGTCAGGACAAGATCCGACCATTGTGGAGGCATTAC
TTCCAAAACACACAAGGACTTATCTTTGTGGTTGACAGTAATGATCGGGATCGTGTTGTTGAGGCTAGAGATGAGTTGCACAGGATGTTGAATGA
GGATGAACTTAGGGATGCTGTGCTGCTTGTGTTTGCTAACAAGCAAGATCTTCCAAATGCTATGAATGCTGCCGAGATCACTGACAAGCTTGGTC
TCCACTCCCTCCGTCAACGTCACTGGTACATCCAGAGCACATGTGCTACCTCTGGAGAAGGGCTGTATGAGGGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E530382] SGN-U207628 Petunia hybrida Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T322332 [Download] [View] Facility Assigned ID: LIB4113-009-Q6-M1-F8
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5