Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E531852

Search information 
Request: 531852Match: SGN-E531852
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C318012Clone name: cPHA-7-N23
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E531852Length: 540 bp (673 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E531852 [] (trimmed) TTGAAGGGATGAATTCGTTAAAAAAGCTTCACCTAGCAAATAATCAATTCACTGGAGAACTCCCTCCCATATTCGGTGAATTGCCAAAGCTCGTG
GAGTTGAATGTACAGAACAATAAGTTTGAGGGTCCGATTCCTCCTTCCCTTTCTCGTCTATATTTTTCAGCTTTTCAAGGCAATGATGGTCTTTG
TGGCCCACCTTTAACAAAATCATGCAATGGGGAAGCACCAAAAAAGCAAGAATCATCAGTTTGGAAGACTATCCTTATAGTTGTGGTGGTAATAG
TAGTCATAGGTCTTATATTATTTGCCATTGTATTCATCTCCCGTCGCAAGAAAAATACCCCACAGGAAGGAGGATATTCAACTGTGACACCAACA
ACTCCTGAACCAAAGGTCCCTTCATCTGATCTAAACAAAATGGAACAAGGCCAAGTATCTCCTGATCGTTCTAACGACGGCAAAAGAGCTGAACA
AGCTGGACAAAAGCTTTTATTCTTGAAAGATGACATAGAGAAATTTGACTTGCCAGATTTATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E531852] SGN-U207852 Petunia hybrida Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T323950 [Download] [View] Facility Assigned ID: LIB4113-026-Q6-M1-F11
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5