Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E532254

Search information 
Request: 532254Match: SGN-E532254
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C318123Clone name: cPHA-8-C15
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E532254Length: 560 bp (698 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E532254 [] (trimmed) AGAATATATTGCAACCATTAGCATACCATTACAGAAAAGAGGAGAAGCTGGTAGTATCAGAGTACATTCCAAAAGGCAGCCTGTTGTATCTGCTA
CATGGTGATCGGGGGATAGCACATGCTCAGCTAAATTGGCCTACCCGCCTGAAAATCATCCAGGGAGTTGCCAGTGGAATGAAATTTCTCCATAC
TGAGTTTGCATCATATGATTTGCCTCACGGGAACCTTAAGTCTAGCAACATTCTTCTTAGTGCAAACAATGAACCACTTTTAACAGATTATGCCT
TTTACCCACTAATCAACAACTCGCAAACTGTCCAATCTCTTTTTGCTTATAAATCCCCAGAAGCCACACTACAGCAACAAATCTCTCCGAAAAGT
GATGTTTATTGTCTTGGAATCATAATTTTAGAAATCATTACTGGGAAATTCCCGTCACAGTATCTCAGCAGCCAAAACTGTGGAACCTGATGTTG
TGCAATGGGCGCGGTCAGCAATTGAAGAGAAGAGAATAGCAGAATTGATTGATCCAGAGATAGCAACAGCCAAGGATTCCCTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E532254] SGN-U208141 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T324394 [Download] [View] Facility Assigned ID: LIB4113-031-Q1-M1-C3
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5