EST details — SGN-E532332

Search information 
Request: 532332Match: SGN-E532332
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C318113Clone name: cPHA-8-B6
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E532332Length: 513 bp (682 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E532332 [] (trimmed) AACAAATGGGAGATGGGTCGACAACAGGCCATACCATCATTGCTTACAACCTGAAAAAGGTTTATCCAGGAGAGAGATGGAAATCCTGAGAAATT
CTGCACTGAGAGGGTTGACACTTGCTGCGCCAGAAGGGGAATGCTTTGGTATGCTTGGCCCGAATGGTGCTGGCAAAACTTCTTTCATTAGTATG
ATGATTGGACTTACAACCCCAAGCTCCGGTGCTGCATATGTTGACGGTCTGGATATACGAACAGAGATGGATAAGATATACACTGACATGGGTGT
ATGTCCTCAGGATGACTTACTCTGGGATACATTAACAGGAACAGGAACACTTGCTTCTCTATGGAAGGCTTAAAAATCTCAAAGGAGAGGCTTTG
AATCAAGCAGTTGAAGACTCTCTTAAGAGTCTCAACCTGTTTAACAGAGGCGTTACTGACAAACAATCTGTGATGTACAGTGGTGGAATGAATAG
GACGCTAAGTGTAACTATTTCACTAATTGGAAATTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E532332] SGN-U208237 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T324480 [Download] [View] Facility Assigned ID: LIB4113-032-Q1-M1-B6
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0279 Quality Trim Threshold: 14.5