Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E533037

Search information 
Request: 533037Match: SGN-E533037
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C312479Clone name: cPHA-10-C3
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E533037Length: 532 bp (706 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E533037 [] (trimmed) CACATATACAAATAAAGAACCATCCACCATATAACTTCTTAAATTAGTAAAAAAAAAAAAAAAAATACTTGGATCCCCATAATCATGTCCTCTGC
AATGAATGATGACGATTTCAACGTACGTAAAAGCCAGTTATCTGGCTATGATCGTCTTAGTTGTGAAGGTGGTTCTCCTATGAAAATGTCACCAT
GGAACCAAAGTTGTCATATTAATGATCTCGACATGTATAAATCATGTGATGAGGATGATGGTTCGCAAAATGACTCCAAGATTTGTCTCATTGGT
TCACTTGTTCGTGAAGAAGGCCATATATATTCTTTGGCTACAAAAAATGATCTTCTTTATACAGGTTCTGATAGCAAAAATATACGTGTATGGAA
GAATATGAAGGAGTTTTCGGCTTTTAAATCTAATAGTGGTCTTGTTAAAGCCATTATCATTTCTGGAGACAAGATTTTTACCGGTCATCAAGATG
GAAAAGTTCGAGTATGGAAGGTACAACCTAATAATCCTAGCATTCACAAATCTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E533037] SGN-U207735 Petunia hybrida Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T325256 [Download] [View] Facility Assigned ID: LIB4113-040-Q1-M1-C3
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5