EST details — SGN-E533077

Search information 
Request: 533077Match: SGN-E533077
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C312560Clone name: cPHA-10-G12
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E533077Length: 571 bp (681 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E533077 [] (trimmed) GTTTTTTGCGCGAAATTGAGTAATGGTGAGCAAGCAGCAATCAAAAAGTTGGATACTGGTTCTTCACCTGAACCAGATTCTGATTTTGCAGCTCA
GTTATCAACGGTTTCAAGACTTAAACATGAGCATTTCATGACTCTCATGGGCTATTGTCTTGAGGGTAACAATCGTATATTGGTATATGAGTTCG
CAACAAAAGGCTCTTTACACGATGTATTGCATGGTAGAAAAGGTGTACAAGGTGCTGAGCCTGGACCAGTTCTTACCTGGAACCAGAGAGTTAAA
ATTGCTTATGGTGCAGCAAAAGGCCTCGAATATCTGCACGAAAAAGTTCAGCCTCCAATAGTTCATCGCGATGTCAGATCCAGTAATGTGTTACT
CTTTGATGACTTTACAGCAAAAATTGCTGATTTCAACTTGACAAACCAGTCCTCAGACACTGCAGCGCGTCTTCATTCCACTAGAGTTTTGGGGA
CTTTTGGCTACCATGCTCCAGAATATGCAATGACCGGACAGATAACACAGAAAAGTGATGTTTATAGTTTTGGCGTCGTGCTCTTAGAACTCTTG
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E533077] SGN-U208328 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T325300 [Download] [View] Facility Assigned ID: LIB4113-040-Q1-M1-G12
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0007 Quality Trim Threshold: 14.5