EST details — SGN-E534022

Search information 
Request: 534022Match: SGN-E534022
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C313588Clone name: cPHA-15-E9
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E534022Length: 478 bp (638 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E534022 [] (trimmed) TGGAAGAGAGGAACAAAAATTACATTTGAAAGTAAAGGGGATGAGAGACCAGGCACACTTGCAGCTGATATAATATTCTCAATTGATGAGAAAAC
ACATCCATTGTTCAAGAGACAAGGAGATGACTTGGTTTTTGGTGTTGAAGTCCCTCTAGTCCAAGCTCTCACAGGATGTACAATTACTGTACCTC
TTTTAGGTGGTGAAGAAATGACTATGTCATTTGATGATGAAATTATTTATCCAGGATATGAGAAAATCATAGCAGGACAAGGCATGCCTAAACCT
AAAGAGGAAGGTAGGAGAGGAGACCTTGTGCTACAATTTCTTGTCAATTTTCCTTTAGATTTGAGTGAGGAACAAAAGTCTGAGGTTGTTAGCAT
ACTAGAAGAAGATTTCTCTTGATGTAATTAAAGATGGTGACATAGTCGTTGTGCTACAATTTCTTGTCAAATTTCGCTTAGATTTGTGAGGAACA
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E534022] SGN-U208695 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T326341 [Download] [View] Facility Assigned ID: LIB4113-060-Q6-M1-E9
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5