EST details — SGN-E535179

Search information 
Request: 535179Match: SGN-E535179
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C315367Clone name: cPHA-19-P11
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E535179Length: 392 bp (650 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E535179 [] (trimmed) GCACCATCTCCAGCATCTAAGAGTTCACCACCACCTGCTGAGTCTCCTTCTGATGATGTAGCAGAATCCCCTGAAGAAGAGGCAGAGTCCCCTTC
TGATGATACAGAGGCCCCTTCTCCTTCTGATGATTCCGACGCTCCGGCCAGTGCACCTTCACCATCAGATGATTCTCCTCCAGCCGATGCAACAC
CACCTCCAGCAGCAACTCCATCATCTGCTGGAAAATTGAAGGTTTCCTTTGGTTTCTTTGTGGTTTTGGCCTCAATGGTTGCAGCTTATTAAAGG
GAGCTTTTGTAATACATGTTCAATATATTGTAGAGAGCAGAGAAAAAAAAATGATGTACTCCTATCTCATACATGAAATTAGATGTTAAAACTTT
AAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E535179] SGN-U207672 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T327615 [Download] [View] Facility Assigned ID: LIB4113-073-Q6-M1-H11
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5