Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E536812

Search information 
Request: 536812Match: SGN-E536812
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327080Clone name: Petunia-YF-5-A05
nocartOrdering Not Available
Library Name: Petunia-YFOrganism: Petunia hybrida

Tissue: whole fruit (ovary)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E536812Length: 568 bp (657 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E536812 [] (trimmed) AGGAGATTTGGGAAAGTGAGTATGATAGTTTGATGTACCACATAAAGTTGTTGCTGAAGAAGCTGATGGTTCAGTGAAATTTGGACAAGGTGAAG
GGTCAGCTTATTTGTTTGATCCTGATATTTACACTGATGGAAGGATCTCTGTACAAGGAATTGATGGTGTTCTGTTCCCTATTGAGGAAATTAAG
GTTGCTCCTGTAGCTGCCTCTGTTGCTAAGGTTGTTGCAAAGCCAAGAAGAGGAAAGTTGATGGAAGTAGCATGTAATATGCTGGGGTCATATGC
TTTTAGTAGTTGTCATTAAATTTGTATACTGAGGACTTCTGAAGATAAAGATATGAAAGAAAGAATGTTTTTAGGAGGGCTTTGTTGATGGTGAT
CATCATAAACATAAAAGGGAGGAGAAGTGGTTTGATTGAAGTAGAATTTGGAGCGAATCTTCAGCCCCCTCCTTCCAAAAAGAAGAGAAGGGAGA
ATATCTTTTGTCTTATTTTGTTATAAATACTGTAATTACCTATCAATTTTTTCATTTGTATTTAAGTTTGTTCCACCGACAGTTTGTATCAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E536812] SGN-U207829 Petunia hybrida Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336738 [Download][View] Facility Assigned ID: Petunia-YF-5-A05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0025 Quality Trim Threshold: 20.5