EST details — SGN-E536925

Search information 
Request: 536925Match: SGN-E536925
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327098Clone name: Petunia-YF-5-B11
nocartOrdering Not Available
Library Name: Petunia-YFOrganism: Petunia hybrida

Tissue: whole fruit (ovary)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E536925Length: 465 bp (553 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E536925 [] (trimmed) TTAGCTCTACTACACTCGAAGGTGCTTCTCTCTGAAAGATATATCTGTGAAAATGGCACACTCAAGTGCGCTTGTTTGCAACTGTGTTTCTTCTA
GCTATGTTTGTCATGGCCACTGAGATGGGACCAATGAGAATTGTTGAGGCAAGAACCTGCGAGACCCTGAGCCACCGTTTCAGGGGACCATGCGT
TAGAGAGAAGAACTGTGCCGCTGTTTGTGAGACCGAAGGATTCTCCGGTGGCGACTGCCGTGGATTACGCCGCCGTTGCTTCTGTACCAGGCCAT
GCTAACACCGCTTATATAACTTTGAGAAACTACTATTGAATAAGCACTATTGCTACTACGTACTACTATGATTGTTCAAATATCCATGGTTCTTG
TAGGTTCTAAGCTGGTCGTAATGTTTGATTTTATGCAATTAATTAAGGTGGTAGACATGTAGTGCAGTATGTATTTCCTGTGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E536925] SGN-U207699 Petunia hybrida Build 1 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336756 [Download][View] Facility Assigned ID: Petunia-YF-5-B11.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5