EST details — SGN-E537354

Search information 
Request: 537354Match: SGN-E537354
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327622Clone name: Petunia-YF-9-G06
nocartOrdering Not Available
Library Name: Petunia-YFOrganism: Petunia hybrida

Tissue: whole fruit (ovary)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537354Length: 266 bp (347 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E537354 [] (trimmed) TCCTAATATTAACCCTGTTTTGTTGCCTAAGAAATCTGCTGCTTCTGAGGAAAAGTCATCTCAAACTAAGTCACCAAAATCACCAAAGAAGGCAT
AAGAAGGCTATGTTTCAATTTGATCTGATATTTTGGGGTTATATATGGAACCACTATGTTGTCTAGTTTAATTTGGCACTTCTAGTATTAGTAGT
TTAAGGATGTAAGTTAGATTTTCATCTATGGTTTAATCTGGTGTAAATGTTGCTATGGAAATATTAATAGAAAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537354] SGN-U208565 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337376 [Download][View] Facility Assigned ID: Petunia-YF-9-G06.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0212 Quality Trim Threshold: 14.5