EST details — SGN-E537362

Search information 
Request: 537362Match: SGN-E537362
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327630Clone name: Petunia-YF-9-H02
nocartOrdering Not Available
Library Name: Petunia-YFOrganism: Petunia hybrida

Tissue: whole fruit (ovary)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537362Length: 479 bp (767 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E537362 [] (trimmed) AAATAAGTGACATTGTGGAAACGGACAGTGGTGTTCACATCATCAAGAGAACGGCATAAGTCGTGAATATAATGTGATGTCCGCGGAAGAATTGT
TCGAGTGGTGAAATATTCAGACTTGCGGCAACCAGAAAATGTTGCCACTAGAATGCTTATATCATTACTTATGGACTATAAGAAGATTACACCTA
AAAAAACTTCTTACTAGCCCTTTTATTCCGGGGGTTGAGATGAAGATTTAAGAAAGAAAAAGGAAAAAGAAAAGAAAAGATTATCTTTGCTTATT
TAGTTCCCTTTCTGTTTGTATTTTGGGCAATTTTTATATTGTCCAGAAGCCTCTTTCTGCCTAATTTTGTGTGCGCATGCATGCTCTGGATGTTT
TTGTACTTCTTGTTTCAAAGTCCTTTGGGCATGCTGTGGTTCGTATTCCTCTATTACACTCCAAATGATTGAAGGGATTAATTATTGAAAAAAAA
AAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537362] SGN-U208755 Petunia hybrida Build 1 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337384 [Download][View] Facility Assigned ID: Petunia-YF-9-H02.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0070 Quality Trim Threshold: 12.5