EST details — SGN-E537415

Search information 
Request: 537415Match: SGN-E537415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328531Clone name: letfr83
nocartOrdering Not Available
Library Name: LeTFROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: A mixed sample of mature green, breaker, and red ripe fruits
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537415Length: 636 bp (1265 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E537415 [] (trimmed) GGTTATATTTGTCTATCTAGAGCTAAAGATGAAGGAAAAGCTAGGGTTTTTAGTGTGTGTTTGGTTTCTTGTAATTGGGTCTTGTTTGGGTAGAT
TTGTGGTGGAAAAGAATAGCTTGAGGGTAACTTCTCCAGACTCGATCAAAAATGTGTATGAGTGTGCAATTGGGAATTTTGGGGTTCCACAATAT
GGAGGAACTATGGTTGGTATTGTTATGTACCCTAAAGCTAATCAGAAGTCCTGCAAGGATTTTGCAGATTCTGATATTTCATTCAAAACTAAGGC
TGGTGGTATGCCTGTTTTCGTCCTTGTCGATAGAGGAGACTGCTATTTCACACTTAAGGCTTGGAATGCTCAAAAGGCTGGAGCTGCTGCTATTC
TTGTTGCTGATGATCGCAATGAACCTTTGATTACCATGGACACTCCTGAGGAAGAGGATGCAAAGGCAGATTATCTGCAAAATATAACTATTCCG
TCAGCTCTAATTAGTCAATCGCTTGGGGATAGCATCAAGAAGCAACTATCTTAAGGGGAGATGGTTAACATAAACCTGGATTGGAGAGGCGGATA
GATAACCGCGCGGCCGCCCTTGTATAAAAGGTACCCATACTAATCTAGCGATAAACCTTTTGGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537415] SGN-U574304 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338285 [Download] [View] Facility Assigned ID: letfr83
Submitter: Jocelyn Rose Sequencing Facility: BRC
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0076 Quality Trim Threshold: 12.5