EST details — SGN-E537418

Search information 
Request: 537418Match: SGN-E537418
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188751Clone name: TUS-56-A5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47933 [cLEI-2-M5] Trace: SGN-T79647 EST: SGN-E265033 Direction: 5' Facility: TIGR
Clone: SGN-C188751 [TUS-56-A5] Trace: SGN-T338296 EST: SGN-E537421 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537418Length: 702 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537418 [] (trimmed) ATAATATAAACTACTAAAATAAGGAGAATTATACAACAATATATAGAATTGTAGCAAGTAGCTAGAAAATACATATTAAACATCATGTGATGTTA
AATATAAAAAAGATTGAGGACCTAAAATACTCCTCATTCATCCTCAGACCATTACTTCAATTCCCACATCACAACAAAATACACACTTAAAAACA
GACTTTTCACATGATACTACAACTACTAGGATTCTCATCACTAAACATATGAGTATTAGTGGCAGATTGATCAGCATTAGCAGCAGCAGCAGCAG
CAGAAGTGTAGTAATAAGGATCAGCATAAGTAGTGTAAGGGACTTGGCCATAGTTATTGTTGGTATTGTTATAGTAATAACCGGTGGAAGGAGGA
ACGAATGGTGAACGATTGTACATCATCTGAGGTTGTTGTTGTTGATGTTGCATAGCATGCCTGTTTTGAAAATTCATTAGCATTTGTGCTGGATT
GTACTGTTGTTGTTGGCCTCCGTTGTTCATGTTCATTAGCATCGAGGCAGAGGAAGGATGATGATGACCACCGGTGGATAAAGATCCCGGTATAG
CATTGTTTTGATGACCTTGAAATCCACCCGCGTTCAAGAATGCAGCAACGTTGTTGTTATTGTTAGTAGTAGTAGTAGTAGTTCCATTGTTGTTA
TTCCCATGAAAACCAGCAAGATTCATCATTGAGTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537418] SGN-U567519 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338293 [Download][View] Facility Assigned ID: TUS56A05_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5