EST details — SGN-E537426

Search information 
Request: 537426Match: SGN-E537426
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188754Clone name: TUS-56-A8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47937 [cLEI-2-N11] Trace: SGN-T79689 EST: SGN-E265075 Direction: 5' Facility: TIGR
Clone: SGN-C188754 [TUS-56-A8] Trace: SGN-T338298 EST: SGN-E537423 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537426Length: 551 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E537426 [] (trimmed) TGTTCTTTCTTGAATTTCATTATATATAATGTCAAGCAGACGATCACGTTCCAGAATAAGCGATGATCAAATCGCTGATCTTGTTTCCAAGTTGC
AACAACTTATCCCTGAAATTCGTAATAGACGTTCTGACAAGGTTTCAGCTTCAAAAGTGCTTCAAGAAACTTGCAACTATATAAGAAATTTACAC
AGAGAAGTGGATGGATTAAGTGAGAGATTATCACAACTTTTGGAATCAACTGATAGTGATAGTGCTCAAGCTGCTATTATTAGAAGCTTACTTAT
GTAGTAGCTATTTAATTAAATAGCTCAAACTTCATTAAAATTTCTATTATTAAAAAAAGATGGAGCATTTATATTATTAATTAGGGTTTTTTTGG
CCACTATAGGTCAAAATTAATTTCTATTTTTCTGTTTTCCAATTTTGAATAGTTCTTTTTTTTTCTTTTACTTTGTGTTGTATTGTTGTATCCAT
CTGTTTTAAGAGCTGATGTTTCTTTGATCTCAGCCTTTTTTAAGTATATAAGTATTTTGAGATGTTTTTATCGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537426] SGN-U568309 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338301 [Download][View] Facility Assigned ID: TUS56A08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5