Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E537520

Search information 
Request: 537520Match: SGN-E537520
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188809Clone name: TUS-56-C15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48310 [cLEI-4-B9] Trace: SGN-T80371 EST: SGN-E267224 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537520Length: 459 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E537520 [] (trimmed) GTAAAATAACAACTGTTACAACGTACTATATATATTATATGGGACTCTTGCCCACATTGTTTAAGCACAAAGAATAAATGCACCGCCTAGCATGA
ACAGAGCAAAACTAATGTATTACACTAACTAATCCACACATACAATACAAGTTTTAGGAATTAAAACCACCCCTCATATCACACACTTCCTAAAG
CCAACATCTGATAATACACGACACTGAATGACCACATACCATACACCTCCAAGAACCACTAATCTATTCAATCCAGTTTTCATACTATCTGTTAA
TCACAACTTTTTTGATCTGTTGGTCTGCTACTCCCACCTGTTCGATTAGCTTCTCCCACTCTTGATGCCAAAGCAAGAACTTCATGTGACATCTC
CCAGTTTCCACTTTTCCTTCCCCAACTTGATCCTCTAGGATGGATTCCTGCGCTATCACTCTCATCTACTGTAATTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537520] SGN-U566382 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338395 [Download][View] Facility Assigned ID: TUS56C15_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5