EST details — SGN-E537595

Search information 
Request: 537595Match: SGN-E537595
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188853Clone name: TUS-56-E11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48591 [cLEI-5-C13] Trace: SGN-T80446 EST: SGN-E266474 Direction: 5' Facility: TIGR
Clone: SGN-C188853 [TUS-56-E11] Trace: SGN-T348792 EST: SGN-E547917 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537595Length: 570 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E537595 [] (trimmed) GTTACAACCAACAGTAATGACATACAACATGTTGATCAATGCATATGCGAGGGGAGCTCAAGAATTAAGGTTGCCACAGCTTTTGAAGGAGATGG
CAGCACTTAATCTAAAACCTGATTCTATTACATATTCCACAATGATATATGCCTTCATCCGTGTGCGGGATTATAAGAGGGCATTTTATTTTCAT
AAGCAGATGGTAAAAAACCGGCAAGTGCCTGATGCTGAATCATATGAGAAGCTACGGGCAATTCTGGATGTAAAAGCTGCCATAAAGAACAGGAA
GGATAAAAGTGCTTTAATGGGAATAGTTAGAAGCAGTATGGGCTTATTGAAAGAAAAGAAAAAGGGAAAGAAGGATGAATTCTGGAAAAATAGAA
AAAAAGGATCGAGATTTCAAGGACAGTAGTAGCTATATTTTTTGTCTTTGTCATTACCTAATCAACTTTCANTGAGTTAGCTTAGAATTTTCCTA
TTTCTTTTGGTGGTTATCTTCAATCCAGCCTGATTGAGATGCTCATTTGTAAAGTTGTATTCTACCTTTTAGCATAAAAAATGATACATTGACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537595] SGN-U581736 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338470 [Download][View] Facility Assigned ID: TUS56E11_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0109 Quality Trim Threshold: 12.5