EST details — SGN-E537651

Search information 
Request: 537651Match: SGN-E537651
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188887Clone name: TUS-56-F21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48780 [cLEI-5-N12] Trace: SGN-T80566 EST: SGN-E266594 Direction: 5' Facility: TIGR
Clone: SGN-C188887 [TUS-56-F21] Trace: SGN-T338528 EST: SGN-E537653 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537651Length: 758 bp (838 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537651 [] (trimmed) CGGATGATATTTGTGTTATAATCCAAATCAAAACCACAAAACCGTTCCAACAGTATTCATACTCTCTTTCAATTGAGACTCTACGAATTCGCTTA
TCTGCAAGCGATTTTCACAAGAGAGCTTAACAAACATAAACAGCATTGATCGTATTCCTTTTTCGGACCCAAAGTGTTGGGGAGCACTGTGACCT
TTGATTTTTGGGTCTTGGTGGTTGTTGAAAGGTAGATTAGATAAATGATCTACCGATGACCTTAGGGGACGGGGAATGAGATTTCACAAAATCTA
AGCTTGGACACCAGGGCCTCACAAGTTATAGTTATCTAGTCCTAGATCCCTAAGAGCATCAGTTGCAGCATTCTTACAGCTCTTGTAATTCATCT
TAGCCTTTCTTATTAGCTTCTCAATGCCATTACCAAGCAAAATAGTTCTGTTTTCTGGATTCCTAACCACAAGATTTCGGATCATGAAACAACAG
CTTCTTTGCAGTAGCTCTGATTCTGGAAACCTCTGCATAGCTTGGATAACAATATCACCAGCTCCGGCTTCAATAGCACACGCAGCATTATGTGG
AGACCTCAAGGACAGTACAGTTATCATAGACATGACCTCATGTAGAACAGCCGGATCATTGGAAAATCTCGTTGCAAGTTTCATAAGCTTGTTCA
TGCCATCCTTATCTACAATAGCACTCTTGTTTATGTCACTTCTTGCCAACTTAGATAATAAAGAGCAGCAAGTTATGGCTACAACTTTTTCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537651] SGN-U575465 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338526 [Download][View] Facility Assigned ID: TUS56F21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0008 Quality Trim Threshold: 20.5