EST details — SGN-E537745

Search information 
Request: 537745Match: SGN-E537745
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188942Clone name: TUS-56-I4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C49207 [cLEI-7-H10] Trace: SGN-T81078 EST: SGN-E266853 Direction: 5' Facility: TIGR
Clone: SGN-C188942 [TUS-56-I4] Trace: SGN-T338623 EST: SGN-E537748 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537745Length: 514 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537745 [] (trimmed) GAAACTGGAGAAGAAACTAACACAATTAATTGTCAAGATGCAATCACTTCCAAATTATTATTATTTCCGTAAGTATTTCGAGACAACATCAAGAG
AACATTTTATTTTCATTTTAAGCTAGGAAGACGCAAACCACCATGGTATTTTCATTTTAAGCTAAGAAGGATACAAACAACCATGGCCTGATATG
CTGATTACTGGCATCCGCTTCAACACACCAAACACAGCCTAAAGATTTGCTTGACCAACTCGGACATGAACCCGATGCCATGAGGGGTTCAGGAT
TCCTCTCAGATTCCAGACAGAATCTATACTTTCAGGGTGGACATTTGCAGATATATCCACCGCTTTAGCAACTATTTCCGCACTCTGGGGAATAT
TTGCCTCAGCTTCAAAAAAGACCCATGCCCATCTGTCACTGCTTGAATCATCAGCAATATATGGAACACCAGTTCTCTGGTATCTGGTGGCTTCC
TCCCAAGTTTTACCACCATCTATAGACACGTCTACCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537745] SGN-U581608 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338620 [Download][View] Facility Assigned ID: TUS56I04_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0057 Quality Trim Threshold: 20.5