EST details — SGN-E538023

Search information 
Request: 538023Match: SGN-E538023
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189102Clone name: TUS-56-O20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46443 [cLEI-12-J21] Trace: SGN-T82167 EST: SGN-E267748 Direction: 5' Facility: TIGR
Clone: SGN-C189102 [TUS-56-O20] Trace: SGN-T338895 EST: SGN-E538020 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538023Length: 797 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E538023 [] (trimmed) GTTTGTGATCACTTATTTCGACATTTCCAAGCAATATCAGCTGAAGGAAATGGTGTAGTCACAGAGGAGACAATTCAAAGGGCCTTTCTTGAGAC
AGAGAGAGGGTTTACTTCTGTTGTTTCGGAAAATTGGCATTCTCGACCACAACTAGCAACAGTGGGGGCATGCTGCCTGGTTGGAGCTATATATC
AGCAGACACTCTTTGTAGCAAATCTTGGTGACTCTCGTGTAGTCCTTGGAAAGAAGGTTGGAAACACTGGAGAAATTGCTGCCATGCAGCTATCA
ACGGAGCATAATGCCAATATTGAGTCTGTTAGGTGGGAGCAAAAAGACTTGCATCCAAATGATCCTCAAATTGTTGTTCTTAGACATGGTGTTTG
GAGGGTAAAAGGAATAATTCAGGTCTCAAGATCCATTGGTGATGTTTATCTTAAACACACAAGATTTTGCAGGGAACCAACAAATGGAAAATTCA
GAGTTCCTCAACCCCTTAATATGCCTATCCTGTTGGCCACTCCAACAATTTTAAAACATCCTCTACATCCAAATGACTCCTTCCTCATATTTGCT
TCTGATGGTCTATGGGAGCACTTGAGCAATGAAAAGGCCGTTGAAATTGTGAAGAGTCACCCTCGTAAAGGAAGTGCAAAGAGGCTTGTCAAGGC
TGCTCTCCATGTAGCTGCCAAAAAAAGAGAGATGCGATATTCTGATCTTCGAAACATTGACAAAAAGGTCCGACGTCATTTTCACGATGATATAA
CTGTAATTATTTTATTCTTAAACATGACCTGATATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538023] SGN-U571855 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338898 [Download][View] Facility Assigned ID: TUS56O20_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5