Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E538082

Search information 
Request: 538082Match: SGN-E538082
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189141Clone name: TUS-57-A11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46863 [cLEI-13-O24] Trace: SGN-T82620 EST: SGN-E268559 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538082Length: 544 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538082 [] (trimmed) AAAAAAGTTTTACTTTCTTTTACTAATTTCAATCAAACTTTAGGGAAAAAGTTTTTACTTACCCCCCCCAACGTTGGGGTTGTACATACCCCCGG
AAACAAAATTATTTTTCTAGCTATGCCAATTTACATGGGGGGAATAAACATGCCAAAATTTGTAGAAAAAAAACAAATTTACCTGGCAAATGGAA
CTAGCAATTGAGAAAAATCCCTTTGCATATACCAGCCCGTTACTATTTACTTCGAACATCAGGCCCCCATATGCGGATAGTTTGATCATCACTTG
CTGAAACTAGCATTTGAGGCCTTTTAGGATTCCCGCCCACAAAGTTCACAGTCATTGAATGGCCCCACAAAATCTCAATAGGCTTTGTACCCCGG
CGATTCCCTATGTACACCTTTGAATCTTCACTACCACTGGCGATAAAAGTGCTGTCCAATCCCCCAAAACAGGAGCGTATCACATACTTATGTTG
TCTGGGACCTTCAAACTTCATGGGGCTAAGCCACCCCCCTGCAATATCCCACATATGAATCTCTTGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538082] SGN-U575107 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338957 [Download][View] Facility Assigned ID: TUS57A11_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0228 Quality Trim Threshold: 12.5