Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E538212

Search information 
Request: 538212Match: SGN-E538212
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189224Clone name: TUS-57-D22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47388 [cLEI-16-B13] Trace: SGN-T83400 EST: SGN-E269176 Direction: 5' Facility: TIGR
Clone: SGN-C189224 [TUS-57-D22] Trace: SGN-T339084 EST: SGN-E538209 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538212Length: 774 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E538212 [] (trimmed) CAACTTTTATATTTTTATAAGTAAACGAAAATGATCAAGTTGAGATGCAAAAAGTTCTTCAGAAGCAACTCAAAGGTTGCAAGTAGTAATGCCGT
CGTAGCAGATACCAAATTAGGTGGTGAAATAAAATGGGAATTACGTCCAGGAGGTATGTTGGTACAAAAGAGAGAATGTGCAGAGAATGATGGAG
ATTCAATTATCACACTTAGAGTCTCTACTGTAACTCAATGGCATCACATTTCTATACAACCAACTTCATCTTTTGGAGAATTAAAGATGGTATTG
GCAATGGTAACTGGTTTAGAACCAAATGAGCAAAGACTATTATACAAAGGGAAAGAAAGAGAGGATTGTGAATACTTGCACATGGTGGGGGTGAA
AGACAAAGACAAAGTGTTACTCTTTCAAGATCCATCTATCAAAGAGAGGAAACTTGCAACAAATGGACATGTCCAAGATATAGGATCCACTTACC
ACACCATTTGTGTCTAATGAGTAACATTATTAGTGTGTGCAATTTCTTGCCTTTTCTTTAAAAAACTAACCCCCTCATCCCCCTCCACTCCCCTC
CTCATCAAGAAAATGAGTGATGATGGATCAAGATTGGTGATAAGTATATGCTCACCAACTTAGATCGACTAGATTATGTGGTTGTTTTTATGGTG
TGTAATGCCAAATTTTAATTTTATATGCCCTGGTAGCATATATCAAAATTCAAAATTAATGTGTAATCTACTCCAGCATCTCGATTAGGTTATCG
AGTTTGTAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538212] SGN-U585320 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339087 [Download][View] Facility Assigned ID: TUS57D22_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5