EST details — SGN-E538332

Search information 
Request: 538332Match: SGN-E538332
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189306Clone name: TUS-57-H8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C63743 [cLEM-2-L7] Trace: SGN-T84081 EST: SGN-E269616 Direction: 5' Facility: TIGR
Clone: SGN-C189306 [TUS-57-H8] Trace: SGN-T339204 EST: SGN-E538329 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538332Length: 819 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E538332 [] (trimmed) GTAGCAGTCAATGTATATGCTTTCAGTGACAAATATACTGACATAGCTACTATAGGTACGCTGGCAAAGTACACAGGTGGTCAGGTGTACTACTA
TCCAAGTTTTCAAGCGTCCGTTCACAAAGATAGATTGCGTCACGAGTTAACCCGAGATCTTACAAGGGAGACTGCTTGGGAGTCTGTCATGCGCA
TAAGATGTGGAAAAGGTGTTCGTTTTACAACATATCATGGGAACTTCATGCTGAGATCCACTGATCTGATAGCACTTCCTGCTGTTGACTGTGAT
AAAGCATATGCAATGCAGTTATCCCTTGAAGAAACACTACTCACTTCCCAGACAGTATTTTTCCAAATTGCTCTACTATACACATCATCTTCTGG
AGAAAGGCGCATTAGAGTACACACAGCAGCAGCACCGGTTGTTTCAGATTTAGGAGAAATGTATCGCCTAGCTGATACTGGTGCTATCATTTCTC
TTTTTACCAGGCTTGCCATTGAGAAAACTCTGACCTCTAAATTAGAGGAGGCTCGAAATTCTATTCAACTCAGGATTGTGAAAGCTCTTAGAGAA
TATCGAAATCTCCATGCTGTTCAGCACCGTGTGGCTGGAAGGATGATTTATCCAGAATCTTTAAAGTACTTGCCATTATATGGATTAGCTTTATG
CAAAACAACTGCCCTTCGCGGTGGATATGCTGATGCTCAGCTTGACGAACGATGTGCTGCTGGATATACCATGATGGCTTTGCCCGTTAAAAGAT
TGTTGAAGCTTCTATATCCTAAGTTGATCCGTATAGATGAATATCTTCTAAAAAACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538332] SGN-U571604 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339207 [Download][View] Facility Assigned ID: TUS57H08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5