EST details — SGN-E538336

Search information 
Request: 538336Match: SGN-E538336
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189310Clone name: TUS-57-H12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C63768 [cLEM-2-N19] Trace: SGN-T83958 EST: SGN-E269493 Direction: 5' Facility: TIGR
Clone: SGN-C189310 [TUS-57-H12] Trace: SGN-T339214 EST: SGN-E538339 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538336Length: 678 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538336 [] (trimmed) GGGCAGCAAAAAAAATTCAGTTATGCAAAGCAAATGCATGTACAAGATCTCTACAAAAAGTCTAAATAAATCCCACTCAAACGCATACCCTATCC
CCACAACATCAAGAATATAAATAACTGCAACATTGTTCTATTTAATGTCTCATCTCACTCTAACCAGACCAACACGTGAAAATAAATACTAGTCA
ATTAGCATTTTTTTCATGTTCACCCCAAGCAAATGGGGCAGCGGGGTAATGCTAGCATTTAAGGACGATCACAATCTTCCTGCTCCCACATCATA
ATGCATGGCTGGTCCAGGTGTATGAAATGATCCCAACATGAGGAGAAATATTAGTTCTTCAACTAATGTTACAAGGAAAATCATGTAAGCTCAGC
AATCAATGGTGTCAATTAACACTAACAGCAGATTTCTTCCATGGAAGCTTTTGCTCATTGGATGAACCATCCATAGTTGCAAGTGGCAACAAGTT
CCAACTTCTTCAGGAACCGCCACACAGTAGAAGACCACAAATGATTGAACATACAGGAACCCTTTATGCATTTTTGCTGGACTTGTCGGTGTACT
TGCAGAATCCAATCCTGGGAACCAATAGAACCACCAACTGGATCCTCCATCGGATTTGCAAGCAAGAAGAAAGCTTCTCTAGGCTGTTCACCTTG
CCTCACAAGATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538336] SGN-U571604 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339211 [Download][View] Facility Assigned ID: TUS57H12_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0019 Quality Trim Threshold: 20.5