EST details — SGN-E538379

Search information 
Request: 538379Match: SGN-E538379
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189338Clone name: TUS-57-I16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65003 [cLEM-8-A19] Trace: SGN-T85475 EST: SGN-E271924 Direction: 5' Facility: TIGR
Clone: SGN-C189338 [TUS-57-I16] Trace: SGN-T339255 EST: SGN-E538380 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538379Length: 777 bp (905 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538379 [] (trimmed) AATGGCTGGTAAAAAGCTCACGTATATCATTAATATTAATAATAATAAGAATGGCGATTACTACTTGAATTACATATTTTATATATCTAATAAAT
AAAAGTAGGGGCCTTGAATTTTCCAGGCTAAAAACAAGAGCTTCATTGGTATAGGGGTGGAGTCACCCTTGTTTCTATCCCATCCATAGCTTCAG
AACTCTATCTTTACCACCAGATGCTACTTTTTCGCCGTCTGGACTCCAGTCGACCGCGAAAACCTCGTCAGCATGGCCGGGAAGGTCTTGTTTCA
ATTTTTTTGTCCGGATATCCCAAACCTTCAAGGTTGAATCTTTGCTCCCACTCAAAAGTAGCCTACTGTCGGCTGACCAGCTGTGCAAAACACAA
GGATAGTAACTAACAGTTGACTGTTGAAGTAATGGAAGATTTGAGTTTTATGGCAAATTTTAACCTTATCTGATAAACAGGTCCAACATGGCCTC
GGAATGCAGCAACAAATTTTCCTGTGGTTCCATTCCATAATTTTACTGACTTATCGAATGAAGCACTTGCTATCCATTGACCATCCGGAGAAAAA
TAAACGTGATTAACCAGCTGTTGATGACCTGTCATGCGAGTTTTTGGGTGCTTGCTGACAGCAGGCTCCCATAGAAACATTGTGAAATCATCTGA
TCCTGATACCAACCTCTCAGGGGCATTACCTCTCATTTTGTTGTACCTTTCAAGTGCTACCTTTTTCATTTCCTCANGAGATGCGAAGTGTTTAT
TAGTGTGATCAAAAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538379] SGN-U568855 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339254 [Download][View] Facility Assigned ID: TUS57I16_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5