EST details — SGN-E538385

Search information 
Request: 538385Match: SGN-E538385
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189342Clone name: TUS-57-I20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65397 [cLEM-9-O15] Trace: SGN-T85668 EST: SGN-E268663 Direction: 5' Facility: TIGR
Clone: SGN-C189342 [TUS-57-I20] Trace: SGN-T339259 EST: SGN-E538384 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538385Length: 580 bp (978 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E538385 [] (trimmed) CAGTTTTTGACAGTTTGATAATCTTCGCAAAGCTGAACATATTCAAAACCCTACTAAAACCTCTGTTGTTTTTCCTCTTAAAGAGTCAATAGTAG
TCTTAACCAAAAATTTGTAAGCGGAGATTAATGGCAGAAACGATGGAAGTGGAAGTGGAAGCTGCGGCGGCGGCAGAGAGAGAAACAACCAACAG
TGTCATATGTCAGTTGGCTGACCCAGAAGGGAATCCGTTGGGTGCTGCCTTGTACCTCCCTGAAAACGCTAGTCCAAAAGAGCTTAATCAAGTTG
TCAATAAGCTTCTCAGCAATGAGGAAAAGTTGCCTTATGCATTTTATATCTCAGATGAAGAGCTTGTGGTGCAGCTTGGATCATACTTAGAGAAG
AATAAAGTGTCTGTGGAAAAAGTCTTGACCATAGTTTATCAACCACAAGCAGTGTTTCGAATCCGCCCTGTCACTCGTTGTTCGGCCACAATTGC
TGGGTCATACTGAAGCTGTTCTTTCAGTTGCCCTTCAATCCTGATGGACGACAGTTGGCAAGTGGATCTGGTGACACTACAGTTCCTTTGTGGGA
TCTAAATACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538385] SGN-U569420 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339260 [Download][View] Facility Assigned ID: TUS57I20_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5