Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E538673

Search information 
Request: 538673Match: SGN-E538673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189530Clone name: TUS-58-A16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68884 [cLEN-8-D14] Trace: SGN-T88764 EST: SGN-E274068 Direction: 5' Facility: TIGR
Clone: SGN-C189530 [TUS-58-A16] Trace: SGN-T339550 EST: SGN-E538675 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538673Length: 738 bp (915 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538673 [] (trimmed) GGCCTGCAACCTTCCCCTTGCAATCATTTAAACGAAGTGAAGCCAAAGCGAACAGCTACATCTGCCCCCTAAAGTTAGCTGGATCAAATTACAGC
CAACATGATGTTACTGGCAAAAAACTTGCACATTTACAACCTCAGTATACACTGTCAATTACCGTCCTATGTACAACAGACCCACCAATCTCCCA
TCCCAATACCCCAAAATCCCTCTACAATAATCGACAACAACATATGCAACCAACTTGTTCCCGAGTCCTACATCTGGAGCCACTAGGCACTTGCT
CAAGAAAGATCATATGCTTCATGTCTTCCAGGAAGCGCCAATACACAGATCCTTCTGTTTCCTTGGATCTGTTCCAAGTCAGCAATCTTATCAGC
GGTTACTGTGCAACGTGCACACCAGTTCATGTTGCTCCCTGAGCTCATTGAAACCATTCAGGTTGTCCTTTAATTGCCCCTCTAAGAAGCCAAGT
ATATTTTTAGAATACAAAACACACATTGCTAATCCCAGAATCACCCCCGACTAGTCATGCTTTTCAAGCCCTCTTCAGAGAGAGTCCACGAAAGC
AAATGTCCTCCAGAATCTCCACTCAACAACTGTTTCAGATCACTAGTAAGGTGGAGGGCAGTTACAAGATGCTTATGAAACTTCAGTACCTTGCT
GAGGATCAACCTATACTCTGGTACTCTATCCCCGAGTCCTATCCCTCCAGTAGGATTGCCACTTGGTTTACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538673] SGN-U582780 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339548 [Download][View] Facility Assigned ID: TUS58A16_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5