EST details — SGN-E538679

Search information 
Request: 538679Match: SGN-E538679
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189532Clone name: TUS-58-A18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69071 [cLEN-8-N9] Trace: SGN-T88754 EST: SGN-E274058 Direction: 5' Facility: TIGR
Clone: SGN-C189532 [TUS-58-A18] Trace: SGN-T339551 EST: SGN-E538676 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538679Length: 783 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E538679 [] (trimmed) CCACAATTGCCATTGTATGAGAGTTTGTGTATTCCTGATTTGCTTAATCCTCAAAGTCTTCAAAATTTTGCTAATATCTTTTGGCCTCAGGGTAA
TCAACATTTCTGCAATTTGGTAAAGTCTTATTCTAATCCACTTGTGGAATTGGATGAGATTTTGAAAAGGATGATTTCGGAGAATTTGAGATTAA
AAATTCACATTGATGAATTGTTGAATGCCAATTATTTCCTATTTAGATTTACACATTACAAGGGATCATCAATTACTGGTGGAGATGAGAATAAC
AAAGTTGCTGGATTGGGTGGCCACACAGATGGTAACTTCTTGACTTTTATATCGCAAAATCAAGTCAATGGATTGCAAATCAACAAAAATGGAGA
ATGGATTGATGTGAATATTTCACCAAATTCTTATGTTGTTTTGGCTGGTGATTCCTTCAAAGCTTGGACAAATGGTCGATTGCATTCTCCTCTTC
ACAGAGTAACAATGTCCGGAGAAAATGATAGACTCTCCATTCAATTATTTTCATTATCAAAACCAGGTCACTTCATCGAGGCACCAAAAGAACTA
GTGGATGAAGAACACCCTTTACTCTTCAAGCCATTTGAAATTATTGGATTATTTGAGTATGGTACCACAGAAGCTGGCTATACAGCTCCTCCAAG
TGATCTTCTCAAGAGTTATTGCGGTGTTTGATATGCTAATTGCGAATTTCCGCTTCAGCAACCAACTTTTCTAATAAGTTTCGTGTGAAAAATCG
TGTGTTTAATTATTATGCATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538679] SGN-U580211 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339554 [Download][View] Facility Assigned ID: TUS58A18_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5