EST details — SGN-E538718

Search information 
Request: 538718Match: SGN-E538718
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189555Clone name: TUS-58-B17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65659 [cLEN-10-O17] Trace: SGN-T89373 EST: SGN-E275501 Direction: 5' Facility: TIGR
Clone: SGN-C189555 [TUS-58-B17] Trace: SGN-T339591 EST: SGN-E538716 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538718Length: 821 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E538718 [] (trimmed) CCACAATTGCCATTGTATGAGAGTTTGTGTATTCCTGATTTGCTTAATCCTCAAAGTCTTCAAAATTTTGCTAATATCTTTTGGCCTCAGGGTAA
TCAACATTTCTGCAATTTGGTAAAGTCTTATTCTAATCCACTTGTGGAATTGGATGAGATTTTGAAAAGGATGATTTCGGAGAATTTGAGATTAA
AAATTCACATTGATGAATTGTTGAATGCCAATTATTTCCTATTTAGATTTACACATTACAAGGGATCATCAATTACTGGTGGAGATGAGAATAAC
AAAGTTGCTGGATTGGGTGGCCACACAGATGGTAACTTCTTGACTTTTATATCGCAAAATCAAGTCAATGGATTGCAAATCAACAAAAATGGAGA
ATGGATTGATGTGAATATTTCACCAAATTCTTATGTTGTTTTGGCTGGTGATTCCTTCAAAGCTTGGACAAATGGTCGATTGCATTCTCCTCTTC
ACAGAGTAACAATGTCCGGAGAAAATGATAGACTCTCCATTCAATTATTTTCATTATCAAAACCAGGTCACTTCATCGAGGCACCAAAAGAACTA
GTGGATGAAGAACACCCTTTACTCTTCAAGCCATTTGAAATTATTGGATTATTTGAGTATGGTACCACAGAAGCTGGCTATACAGCTCCTCCAAG
TGATCTTCTCAAGAGTTATTGCGGTGTTTGATATGCTAATTGCGAATTTCCGCTTCAGCAACAACTTTTCTAATAGTTTCGTGTGAAATTCGTGT
TGTTTTAATTATTATGCATTTTATGTTTGAATTGNTGTAGTTGGCATTCATGTTTAATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538718] SGN-U580211 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339593 [Download][View] Facility Assigned ID: TUS58B17_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5