EST details — SGN-E538966

Search information 
Request: 538966Match: SGN-E538966
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189699Clone name: TUS-58-H17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73363 [cLER-4-H11] Trace: SGN-T92952 EST: SGN-E278119 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538966Length: 240 bp (901 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E538966 [] (trimmed) TTTGATGCTACTAAGTGCATGTTTTCATGGGGTAATCTCTCTGAGAAGCTTCGGATGGGCCACTTTGATTGCAAAGACGAAGTTATAGTAGATTT
ATTTGCTGGCATTGGATATTTTGTGCTGCCCTTCCTAGTGAGGTGATACTTTTTGTTTTAGAATCACCGTGTTGTTATTTTGTGAATGATGCATT
ATCAAAACCATTTCATTCTCTACCTTTGTGTAAACCTCGAGGGGGGGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538966] SGN-U565137 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339841 [Download][View] Facility Assigned ID: TUS58H17_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5