Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E539009

Search information 
Request: 539009Match: SGN-E539009
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189726Clone name: TUS-58-I20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73602 [cLER-5-G5] Trace: SGN-T92990 EST: SGN-E279481 Direction: 5' Facility: TIGR
Clone: SGN-C189726 [TUS-58-I20] Trace: SGN-T339887 EST: SGN-E539012 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539009Length: 709 bp (933 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539009 [] (trimmed) CATTTCGAAAATTTATGGCAATGAAGCACAGTAGCAGTTACGAGTCCAACACATTATTTATACGTAGATGTAGAAAAATACAGCTCTTTCAGATT
ATACAATAAAACCAACCACCCAATGGAGAAAATAAAAAAAGATGCACAGTTATAATCTCTGTCAAAGCCAACTGCAATACTAAGTGAAATCCTTC
TGAGTTTCTCTACCTTCCAGTAACTGAAATGTAACAAAAGATGCTTCTCTTCCCAAAACAACACTGAAGAAATCAAATAGTAGTATATAATAGTG
GGTACAAAAGAATGGCTATGGCCGGAGAGTTATGATACGGTTGCAGAAATAATACACAACAACATGGATCAAGTATGGCACTCGATGGAATTACT
ATATCCGCCTTAGCATGCACAGCCACCTCTTTGTTCAGTCTCTGAAACTGCCTCTGGAATGCCTTGGAAGTATATATCCTGCTCGTGCTCATTGG
CCAAGGCAGTTTTTGCAATAGACAAGAATGCAGCATCAACATTTATATCCTCTTTTGCTGATGTCTCAAAGTAAGGTATCCCTTTAGAAGTACAC
CACTCCTTTGCTTTCTTCTCAGAAACCACTCGGCTATTTCCACCATCTATATCAATCTTGTTCCCCAGTAATATGAAAGGAAATGTTTTAGGGTC
TGGCGGATTAGCCTGTTTGAGAAATTCTTCATNGCAATTGTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539009] SGN-U582457 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339884 [Download][View] Facility Assigned ID: TUS58I20_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5