Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E539021

Search information 
Request: 539021Match: SGN-E539021
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189733Clone name: TUS-58-J3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73628 [cLER-5-I15] Trace: SGN-T93135 EST: SGN-E279626 Direction: 5' Facility: TIGR
Clone: SGN-C189733 [TUS-58-J3] Trace: SGN-T339899 EST: SGN-E539024 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539021Length: 758 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539021 [] (trimmed) AGCGTGAACACCGAATAAGTTTCACCGATTTAATTGTTTACTCTTTGGTACAATCAGCTGTTCCTCTCTTGGTGTTTGGTTTGTTGAGAAATGTT
TCTACAAAAAAAGAACTTTCTGAAACTCTTCTCAAAATTTTCAAAACAAACCAAACATCAGTTAAAGTAAATCCATATCACTCTGTTTCTTCCTT
CCTGTCCCTGACTCTCATCTTCAGGGACGGGACGGAATTTATGACGATCAATGATCGCCATTACATAGGCCCCACCTATTCATTACTGCCAATCT
GATTTCTATCATCCTCGCGATCTTCTTCTTCATCATCATCATTATTTTCGTCTTCATCTGAGGATAAATGCACAAGCCAACAACTTCCATGTAAA
TGCCCATTAACACACACAAAATACTCCAACCCGTTTTCTATGGTACCCAGCCTCCGCGCTGCGCTCTTTGGTATAAGCCTAGCAGCCGTCATACT
CCAAACCCTACCCCCGCAAAACGGACACCTCACTCCTTCTTCAACCTCCAATTCTTTCGTAATCAAACACGCCCTCGTCTTCGATCTCATAAATC
CCCCAAATACCCCTCTGAAAACCCCTAAATCATCACTCCTATCGCTGATTTCGTGCTCACACGGATCACTAACGTACAATAAATCCGTTCTACAT
CTCCTCATTAAGAAACTCCGACCCGACGTCTTCGAAAATCGAGAAGATTTCATGAAATGACCCGGATATGATTGACCCGTTCGAAAATGTCGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539021] SGN-U574256 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339896 [Download][View] Facility Assigned ID: TUS58J03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0011 Quality Trim Threshold: 20.5