EST details — SGN-E539028

Search information 
Request: 539028Match: SGN-E539028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189735Clone name: TUS-58-J5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73654 [cLER-5-J20] Trace: SGN-T93097 EST: SGN-E279588 Direction: 5' Facility: TIGR
Clone: SGN-C189735 [TUS-58-J5] Trace: SGN-T339900 EST: SGN-E539025 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539028Length: 636 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539028 [] (trimmed) TTCGATGGCGTTGACGGCGGCGATGATATTTGCGTCAGATGCGCAAACAACGCCGCCGTCGTGCGCCTCAAAATTAGTGCCATGTGCACCTTACC
TTAACTCATCGAGCCCCCCAGCGGAGTGTTGTGATCCATTGAGAGAAGCAATAACAAATGACTTAGATTGTTTGTGTAAATTATATGAAAATCCA
ACTTTATTGCCTTCACTTGGTATTAATATTACTCAAGCACTTGCACTTCCTAGGGCTTGTAATATTCCTGGTGATCTCAGTGCTTGTACTTCAGG
TGGTGCTCCAGGTCCAAGTTCTGAAGGCTTGCCACCCCCAGTCACACCAGGAGGAAACAATGGCAACAATGGAGTAAACAAATTTACATGGAGTG
GAATGTCAATTTTACTATTACTTTGTGCTTCTTTGATGATTGCTTAAAAACACTTATTTGTATTCATGTGTTGGAGTTTACATGTATTTTTATTT
GTTTCACTTTATTTTATAATTTTTGTCTAGTGTTACATTCTTGGTGTATGGGTTTTTGTTTAGACCATTTAATATACGTAATTATTATTTATGTT
CTAAATATTGCTAGTCTTTTTGACAAATTAAACTTGTTTCAAAATGTTTGACATTATTAAGAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539028] SGN-U575965 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339903 [Download][View] Facility Assigned ID: TUS58J05_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5