Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E539239

Search information 
Request: 539239Match: SGN-E539239
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189858Clone name: TUS-58-O8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69748 [cLER-12-H21] Trace: SGN-T94403 EST: SGN-E283436 Direction: 5' Facility: TIGR
Clone: SGN-C189858 [TUS-58-O8] Trace: SGN-T340111 EST: SGN-E539236 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539239Length: 796 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539239 [] (trimmed) GAAAAAACTGTTCTTTATCATCTTCCTTCTTCCCAAACATCTCAATTTCATCACTGAGAAGCAAAAGAAGAAGACAATCGGAGAAGCAGAAGCAG
ATAATCAGTTGAGAGGATAAGCGTTTTTTGTTGTTGTACAGAAGAGATGTTGTTTCAAGTAGGAGGACAAGGGACTCGTCCTACTTTCTTTGAAA
TGGCTGCTGCACAACAGTTGCCTTCTAGTCTTAGAGCTGCTTTAACTTATTCCCTTGGTGTTTTAGCTTTAAGAAGACCTTTCATCCACAAAATT
CTAGATTATGAGGATGAGTGCTTTGCTTTGCTTACGCTAGTTCTTGAAACTCATAGCTTACGAACTACAGATGGGTCTTTTGCTGAGTCTTTATA
TGGTCTGCGAAGAAGGGCAGTTAACATAAAAGTTAAGGGTGATAACAAAGGTCTAGACGCCAGAGAAGAAATTAATCACACTGGGTTGGAGAAGC
GCCAAAAAGTTCTTTCAGTTGTGTTTCTGGTCATATTGCCATATCTCAGATCAAAATTGCATTCAATCTACAATAAAGAAAGAGAGGCTGCTCTT
CAAGCTAGTTTATGGGGCACTGAGGATGAGAGATTTGGTGACACTGACTATTTTGATGGAAATGGAAACTCCATAGTTTCAACAAGCAGTTCAGA
TACAGAAGAATCAGTTAGAGATCGTTTGAGAAAGAAAATCCGTAAGATCGTAGCTGTTTGCTACCCATGGATACATGCTGGAAATGAAGGTTTAT
CATTTGCTTACCAGCTACTGTATTTGCTGGATGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539239] SGN-U575082 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340114 [Download][View] Facility Assigned ID: TUS58O08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5