EST details — SGN-E539250

Search information 
Request: 539250Match: SGN-E539250
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189866Clone name: TUS-58-O16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69854 [cLER-12-M7] Trace: SGN-T94477 EST: SGN-E283510 Direction: 5' Facility: TIGR
Clone: SGN-C189866 [TUS-58-O16] Trace: SGN-T349065 EST: SGN-E548190 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539250Length: 664 bp (904 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539250 [] (trimmed) AAAGTAAAATATGATGTATATATATTACTATGAAGATTGGGTTGTAATACAACCAACCACCAAAGTTCATTACAATACTCGACAACATATAAGTA
CTCCAACAAACAAAAATACAAAATAAAAGAGACAACATATTATAAAATGATGGATTAAACTCGATCGATCGATAGATATATCCGTCTTATTTTTC
CCCAATTATGCCTTGGAAAATTGAACTTTCATCAACCTTACTGAACCTTCGAGCAGTCAGTAAAAGGGCTGATCTTGTAAGGAATGCTTACGCCA
CAAGCACTAGGTATACCAGCGGCTTTGCCTAGATTAAGGCCTTTAATAGCATTAGCAGCTGATTTGAGGCAAGTGCATGCTGTCTTTCGATCCGC
GGGGGTCTTGGCTGCGCCCAATAGACCCTTAACTCCACGACAACACCCTCCTAGAGGGCCTTTTCCCTGAAGATAAGGGAGGCATGGAGCTAAGC
CAGATTCAACCTGGCCGCAACTTAGTGCTTCTCCATGGGGTGCAACCACTATCATGCACAAAACAATAAAGCATGCAATTTTGCTAGACATTTCC
ATTTGTTACAAAAATTTGAGAAAAGATAGAGAAGTTCTGTGGACTAGGAATGTATTTGCTTGNAGCACTAAATCGTTTCTGTGTTCAGGCTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539250] SGN-U579687 Tomato 200607 Build 2 127 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340125 [Download][View] Facility Assigned ID: TUS58O16_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0018 Quality Trim Threshold: 20.5