EST details — SGN-E539402

Search information 
Request: 539402Match: SGN-E539402
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189953Clone name: TUS-59-C7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70953 [cLER-16-G8] Trace: SGN-T95496 EST: SGN-E284223 Direction: 5' Facility: TIGR
Clone: SGN-C189953 [TUS-59-C7] Trace: SGN-T340274 EST: SGN-E539399 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539402Length: 800 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539402 [] (trimmed) GGAGAGAGAACGCCCTGCTTTTTCTGTGAGCGGTGATTCTTTGTTTTATGTGAAGGATCGATTTCTCCGTGTGTACGAGTATTCAACTCAGAAGG
AGAATCAGTTGATACCAATTAGAAGGCCTGGTTCAAACAGTCTGAACCAAGGTCCACGAACGCTTTCCTACAGTCCTACTGAGAATGCTATTTTG
ATCTGTTCGGACGTTGATGGGGGCTCCTATGAACTATACATTATACCTAAAGACACTTATGGTAGGGGTGATACTGTTCAAGATGCCAAAAGGGG
AACTGGAGGATCAGCAGTTTTTGTTGCTCGGAACAGGTTTGCAGTGCTTGAGAAAAGCACCAACCAAGTCCTGGTCAAGAATCTGAAGAATGAAA
TTGTTAAGAAAAGCCCTCTGCCTACTGCTACTGATGCAATATTCTATGCTGGCACAGGAAACTTACTGTGCAGGGCAGAGGACAGAGTTGTTATC
TTTGATCTGCAGCAGAGAATTGTTCTTGGAGAGCTGCAGACTCCTTTCATCAGGTATGTCGTTTGGTCGTCCGACATGGAAAGTGTTGCTTTGCT
TAGCAAGCATTCCATTGTAATAGCTGACAAGAAGCTTGTGCACCGTTGTACTCTTCACGAGACAATTCGTGTCAAGAGTGGTGCCTGGGATGACA
ACGGGGTCTTCATTTATACCACACTTACCCACATCAAGTACTGTCTTCCCAATGGCGATAGTGGAATCATCAAAACCTTAGATGTTTCAGTCTAC
ATTTTCTAGAATATGGGAACACTATTTTTTGCTTGGATCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539402] SGN-U586425 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340277 [Download][View] Facility Assigned ID: TUS59C07_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5