EST details — SGN-E539480

Search information 
Request: 539480Match: SGN-E539480
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190000Clone name: TUS-59-E6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71650 [cLER-18-J3] Trace: SGN-T96340 EST: SGN-E282544 Direction: 5' Facility: TIGR
Clone: SGN-C190000 [TUS-59-E6] Trace: SGN-T340358 EST: SGN-E539483 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539480Length: 655 bp (861 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539480 [] (trimmed) TCCCATCACACCCAACGTAATCGAAATTGTCTACACAATCGAGAAAGAGACGCTCATTATTTTCACTAGCAAAATGTAACTAAGGTTCAAACACT
TGAGCTGAGTGTTAAATCACTACTATTTTATTAATCAGCTCTTTGAGATATATGGAAAGTTGAGAGTATTGCTAGTTTAACATGATTAACTGAGT
AACACAAACATTAGACAGATGATTGAAGCCCAATAACGCCACAGCCAACTCTTGCACCTGCGTTTCCAGTTGTCTTACTAAGTTCATGTCCACCT
CTTCCCAGATCATCAGGATCAGCATGCACAACTACTGCTCTCCCCAAGATGGAGTGTACTCCACTAAGAGGAATCTGCATATCTGAAATTGATAT
CTCTGCCACCCCATTAGGACCAGCAACAATGTTGCCTAAATCACCCGCATGACGTACTTCATCCATGGGAGCTCCATGATCTTTCTTAAGTGGAT
TAAAATGAGGTCCAGTGGAATTGCAGCCGTTAGTGGTATCACCCAAGGCATGGATATGGAAAGCGTGAAGACCTGGAGCTAGACCAATTATTCTT
CCTCTCACATGGGTAACACCATTGGATTGCTGGATGAATTGTAAGGATCCTTGCACACTATCGTTCCCGGAGATTACAGCTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539480] SGN-U584417 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340355 [Download][View] Facility Assigned ID: TUS59E06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0013 Quality Trim Threshold: 12.5