EST details — SGN-E539582

Search information 
Request: 539582Match: SGN-E539582
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190058Clone name: TUS-59-G16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72397 [cLER-20-B1] Trace: SGN-T96747 EST: SGN-E285175 Direction: 5' Facility: TIGR
Clone: SGN-C190058 [TUS-59-G16] Trace: SGN-T340455 EST: SGN-E539580 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539582Length: 337 bp (917 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539582 [] (trimmed) GATAACCAGGGATTCGTACTGGGGAATGATGGTGTCTTACTGAAGTATCTTGGATAGAAACAATTGTTAAACAAGGCAATTTTGGAAGCAAATAC
TTGAAACTGAACTACTGTAATTTAATCTATAAACACTTGTAAAATTCTTTGCTGATTATTCTTTGCTGATTATCACCATACCTAAGGGAAGTGTT
CATAGGGCTTGAGATTTTAGATTATCTAATGAAAATATATCAGACTTACACGTTATCATGGAGATGACGTTTTGAAATGTGTTATGATATACCAA
AACATTTCAAACAAATTAAACTTTGATGAGATGAGACATATCTTGGCTTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539582] SGN-U578041 Tomato 200607 Build 2 57 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340457 [Download][View] Facility Assigned ID: TUS59G16_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5