Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E539686

Search information 
Request: 539686Match: SGN-E539686
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190120Clone name: TUS-59-J6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77094 [cLES-1-M7] Trace: SGN-T97445 EST: SGN-E283769 Direction: 5' Facility: TIGR
Clone: SGN-C77094 [cLES-1-M7] Trace: SGN-T97446 EST: SGN-E283770 Direction: 3' Facility: TIGR
Clone: SGN-C190120 [TUS-59-J6] Trace: SGN-T340564 EST: SGN-E539689 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539686Length: 757 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539686 [] (trimmed) CTTTCAAGAATATCACTATGAGATGAATTTTGAAATCTAACAACACCCAAAGAATGAAAAAGAAAACTCCAAATCCCAATATCTCAAAATCCTCT
TCTTTTTTTTCTGGCTACTGAGAAAAATTCCAATATCTTAAGAACTACAGCATGCCTTCTTTTCTGGGATAACTTGTGCAGGACCAGGTACAAGA
ATTTTCTTCCCAGTTAATGAAGCAGGATTACCATTTGCTTGATCATCACCAGCGGCGAGATTCTTCTTGTTCACAATGTTGAAGATCTCTGTCAA
AACAGTTAAGAAGGCGTCCTCGATGTTTGTGGCCTCCATTGCAGATGTCTCTAAGAAGAACAATCCTTCTTTTTGTGCAAATTCTTTAGCATCCT
CGGTGGGAACAGCTCGTTGATCTTCAAGATCGGTTTTGTTTCCGATCAGCATAATAACGATGTTCTTGTCAGCATGTGCACGTAATTCTTCAAGC
CAGCGTGGGATGTGATCAAAGGTCTGACGTTTTGTTATGTCGTAAACCAACAGAGCTCCGACAGCTCCCCTGTAGTACGCACTCGTGACAGCTCT
ATATCTTTCTTGGCCAGCAGTATCCCAGATCTGAGCTTTAACAGACTTATGCTGAATAACAAGTGTTCTTGTCTGGAATTCAACACCAATTGTAG
CTTTAGAATCAAGACTAAACTCATTTCTTGCAAAACGAGCTAGTATTTGAGATTTTCCCACAGCTGAATCACCTATCAAAACAACCTTAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539686] SGN-U569628 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340561 [Download][View] Facility Assigned ID: TUS59J06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5