EST details — SGN-E539729

Search information 
Request: 539729Match: SGN-E539729
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190145Clone name: TUS-59-K7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77674 [cLES-2-O2] Trace: SGN-T97152 EST: SGN-E281992 Direction: 5' Facility: TIGR
Clone: SGN-C190145 [TUS-59-K7] Trace: SGN-T340607 EST: SGN-E539732 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539729Length: 705 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539729 [] (trimmed) AGGAGATGACAAGCTAATCCCTCTATACTCAAAACAATATGCATCAAAGCACTGGAACTAGCTAACTTATACAAGGTAGAGGCAGTTATTTATGT
ACTAGAAGTTACATTGAAAATACCTATTTTTCCAATCAAAGATCTCAATTCACGAAAAGAAAAAATACACAATACACTCACTCATAAATCATTTC
CGCTTAGCTTTTCTATGGCCGCGGTTGAAATCATCATCACTATTTTCACCATCGTCCTCCTCATCAGTAGTGTTGTCATCGCTATCATCATCGTC
ATCAGTCCCGGAGGGAGGTGAAGGATCAAGCCTAGCAGCATCAATGGCCCACTTAATCACCTTTTCAACTTCATCATCGTGATCCTCTTCATCTT
CCACCACTACGTGTTGCTTAGCAGATGATGATGCCGAAGAATAAGCGGGAAGTGAGCTTTTGAGAGCTGCAAATCTGGTAAGCAAGTCATCTGAC
TCGTCCGTTGTTGAGGTAGCTTGATTGTCTAAGTCTAAACCCTTAGGTTTTCTGGGGGGAGTTTGCTTGGATCTGAGGGCTTGAAAACGTTGATC
GAGATCTGGATCGATGAATTGGGTGGAAGAACCACGAGCCATATGAGAATTCAGACTCAGCTTGAGGGACACGTCATCCTCTGCCGCACGGAGCA
GCTCTTCCACCTCCTCCGAATCGCTCTTCTTATTCCGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539729] SGN-U571421 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340604 [Download][View] Facility Assigned ID: TUS59K07_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0088 Quality Trim Threshold: 12.5