EST details — SGN-E539733

Search information 
Request: 539733Match: SGN-E539733
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190146Clone name: TUS-59-K8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77680 [cLES-2-O8] Trace: SGN-T97155 EST: SGN-E281995 Direction: 5' Facility: TIGR
Clone: SGN-C190146 [TUS-59-K8] Trace: SGN-T340606 EST: SGN-E539731 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539733Length: 635 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539733 [] (trimmed) TGCAAAATAAGGGTATGGAGCCAGCGGCAGTTGCTGATGGTCAACGAAGAATGCAAGAATTGATGAGGGAATACGGAGTAACTCCATTCACTCCC
TTAAAAGGACTACTAATACAAGGCCCGATCTTCATCAGTTTTTTTATGGCTATTAGGAACATGGTGGATGCTGTTCCTTCTCTCAAAACGGGTGG
ACCATTGTGGTTTACTGATCTAACTACTCCAGATGATATGTATATCCTTCCAGTTTTGACGGCTTTAACATTCTGGATAACAGTGGAGTTGAATG
CTCAAGAAGGATTGGAGGGAAATCCTGCTGGTAAAACTATAAAAAATGTTTCACGGGCCTTTGCTGTGCTAACTGTCCCACTTACTGCTAGTTTT
GCTAAGGCAATTTTCTGTTACTGGATAACCTCAAATCTTTTTTCACTCTCCTACGGTTTGGGTTAGTATATACTATATAACACTCATTTCTGCTG
AAATATTCATCTGCTCATTGGAATCTGTGTTTCGCGAATGGAATTTGGAATTTGTGAAGGTGAGGGTAAATGCAATCTTTCTACAACATATCTCA
CTTTTCATCTTGTGTGTCAGTGATAAAAGTCACGCGGTCAAAGAAGCACTGGGTATTCCTATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539733] SGN-U576972 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340608 [Download][View] Facility Assigned ID: TUS59K08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5